Biology
Biology, 08.11.2019 10:31, Angela122

What characteristic would you use to place a protist with a cell wall in to either the plantlike or funguslike protists?

answer
Answers: 1
Get

Other questions on the subject: Biology

image
Biology, 21.06.2019 12:30, haileywebb8
80 pts the type of cloud shown here may produce heavy rainfall. this type of cloud most likely occurs in an area of the sub-saharan that is a) often dry. b) often wet. c) very windy. d) usually cool.
Answers: 3
image
Biology, 21.06.2019 19:30, coopera1744
What is the "great pacific garbage patch"? a large area of marine debris concentrated by rotating ocean currents a large area around the pacific rim where debris collects from natural disasters such as tsunamis an area in the pacific ocean where trash is intentionally dumped due to lack of landfill availability a large trash dump located in hawaii
Answers: 1
image
Biology, 21.06.2019 19:40, astultz309459
The many volcanoes located along the edge of the pacific ocean make up the ring of fire. how does subduction play a role in the volcanic activity in the ring of fire?
Answers: 2
image
Biology, 22.06.2019 03:20, gokusupersaiyan12345
Given the coding strand dna sequence tacgttccttcctactactacttgggtac and that the string of bases ctactact represents an intron region, what is the second amino acid in the polypeptide chain? (use the three letter symbol or the full name)
Answers: 2
Do you know the correct answer?
What characteristic would you use to place a protist with a cell wall in to either the plantlike or...

Questions in other subjects:

Konu
English, 26.03.2020 16:12
Konu
Mathematics, 26.03.2020 16:12
Konu
English, 26.03.2020 16:13
Total solved problems on the site: 7543409