subject
Biology, 16.10.2019 13:30 amypeace1978

Which organ is responsible for the secretion of bile?
a. stomach
b. salivary gland
c. liver
d. none of the above

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 14:50
Which of the following is the most likely result of converting forestland to urban development? a.the amount of land available for lumber production decreases. b.fewer trees are needed because cities are made mainly of concrete. c.people discover more efficient ways to grow trees. d. the price of lumber goes down.
Answers: 2
question
Biology, 21.06.2019 17:00
What are the probable phenotypes of their offspring
Answers: 1
question
Biology, 22.06.2019 02:00
Many farmers prefer cattle without horns because it is safer for their herds. the allele for no horns (n) is dominant to the allele for the presence of horns (n). a farmer mates a male with horns to a heterozygous female without horns. what is the chance that the offspring will have horns?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which organ is responsible for the secretion of bile?
a. stomach
b. salivary gland
Questions
question
Mathematics, 14.10.2020 14:01
question
Physics, 14.10.2020 14:01
question
Mathematics, 14.10.2020 14:01
question
English, 14.10.2020 14:01